# Sequences to use for adapter trimming

When performing sequencing on an Illumina instrument, sequences corresponding to the library adapters can be present in the FASTQ files at the [3' end of the reads](https://support.illumina.com/bulletins/2016/04/adapter-trimming-why-are-adapter-sequences-trimmed-from-only-the--ends-of-reads.html) if the read length is longer than the insert size. To remove these sequences and prevent issues with downstream alignment, adapter trimmingis an option in Illumina FASTQ generation pipelines. Sample sheets generated with [Illumina Experiment Manager](http://support.illumina.com/sequencing/sequencing_software/experiment_manager.html) contain the necessary sequences in the **Settings** section for Illumina kits. Illumina kits in BaseSpace Sequence Hub Prep, BaseSpace Sequence Hub Instrument Run Setup, and Local Run Manager have adapter information built into the software. However, some third-party tools require the adapter sequence for trimming be specified separately. The recommended sequences to use for each Illumina kit are as follows.

**Note:** if only one sequence is listed, that sequence is used for both reads of a paired-end run. Where the sequence differs between Read 1 and Read 2 of a paired end run, the sequence for each read is listed.

TruSeq single index (previously LT) and TruSeq CD index (previously HT)-based kits:

* Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
* Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

AmpliSeq for Illumina; Illumina DNA Prep (M) Tagmentation (previously Nextera DNA Flex); Illumina DNA Prep with Enrichment (S) Tagmentation (previously Nextera Flex for Enrichment); Nextera DNA; Nextera XT; Nextera Enrichment; Nextera Rapid Capture Enrichment; TruPath Genome; TruSight Enrichment; TruSight Rapid Capture Enrichment; TruSight HLA; Illumina RNA Prep with Enrichment, Ligation:

* CTGTCTCTTATACACATCT

Illumina DNA PCR-Free Prep, Tagmentation

* CTGTCTCTTATACACATCT+ATGTGTATAAGAGACA

Illumina Stranded mRNA Prep, Ligation and Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus:

* ACTGTCTCTTATACACATCT

ScriptSeq and TruSeq DNA Methylation:

* Read 1: AGATCGGAAGAGCACACGTCTGAAC
* Read 2: AGATCGGAAGAGCGTCGTGTAGGGA

TruSeq Small RNA:

* TGGAATTCTCGGGTGCCAAGG

**Notes:**

* The full adapter sequences for various Illumina library preparation kits can be found in the [Illumina Adapter Sequences Document](https://support.illumina.com/downloads/illumina-adapter-sequences-document-1000000002694.html).
* Illumina Stranded mRNA Prep, Ligation and Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus require additional trimming of a T overhang at the 5â€™ end of the library. See [Trimming T-overhang options for the Illumina Stranded mRNA and Illumina Stranded Total RNA workflows](https://support.illumina.com/bulletins/2020/06/trimming-t-overhang-options-for-the-illumina-rna-library-prep-wo.html) for further details

\
\
\ <br>

|                                                                                                                                                                                                                                                                                                                                                                              |
| :--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------: |
| *For any feedback or questions regarding this article (Illumina Knowledge Article #1314), contact Illumina Technical Support* [*techsupport@illumina.com*](mailto:techsupport@illumina.com?subject=Question%2FFeedback%20Regarding%20Illumina%20Knowledge%20Article%20#000001314%20-%20Library%20Preparation%20\&body=Dear%20Illumina%20Technical%20Support,%0D%0A%0D%0A)*.* |


---

# Agent Instructions: Querying This Documentation

If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter:

```
GET https://knowledge.illumina.com/library-preparation/general/library-preparation-general-reference_material-list/000001314.md?ask=<question>
```

The question should be specific, self-contained, and written in natural language.
The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.
