What sequences do I use for adapter trimming

When performing sequencing on an Illumina instrument, sequences corresponding to the library adapters can be present in the FASTQ files at the 3’ end of the reads if the read length is longer than the insert size. To remove these sequences and prevent issues with downstream alignment, adapter trimmingis an option in Illumina FASTQ generation pipelines. Sample sheets generated with Illumina Experiment Manager contain the necessary sequences in the Settings section for Illumina kits. Illumina kits in BaseSpace™ Sequence Hub Prep, BaseSpace Sequence Hub Instrument Run Setup, and Local Run Manager have adapter information built into the software. However, some third-party tools require the adapter sequence for trimming be specified separately. The recommended sequences to use for each Illumina kit are as follows.

Note: if only one sequence is listed, that sequence is used for both reads of a paired-end run. Where the sequence differs between Read 1 and Read 2 of a paired end run, the sequence for each read is listed.

TruSeq™ single index (previously LT) and TruSeq CD index (previously HT)-based kits:

• Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

• Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

AmpliSeq™ for Illumina; Illumina DNA Prep (M) Tagmentation (previously Nextera™ DNA Flex); Illumina DNA Prep with Enrichment (S) Tagmentation (previously Nextera Flex for Enrichment); Nextera DNA; Nextera XT; Nextera Enrichment; Nextera Rapid Capture Enrichment; TruSight™ Enrichment; TruSight Rapid Capture Enrichment; TruSight HLA; Illumina Stranded mRNA Prep, Ligation; Illumina Stranded Total RNA Prep, Ligation with Ribo-Zero Plus; Illumina RNA Prep with Enrichment, Ligation:

• CTGTCTCTTATACACATCT

Illumina DNA PCR-Free Prep, Tagmentation

• CTGTCTCTTATACACATCT+ATGTGTATAAGAGACA

ScriptSeq and TruSeq DNA Methylation:

• Read 1: AGATCGGAAGAGCACACGTCTGAAC

• Read 2: AGATCGGAAGAGCGTCGTGTAGGGA

TruSeq Small RNA:

• TGGAATTCTCGGGTGCCAAGG

Nextera Mate Pair:

• CTGTCTCTTATACACATCT+AGATGTGTATAAGAGACAG

Notes:

• Adapter trimming is not required for TruSeq Targeted RNA Expression, TruSeq Custom Amplicon, and TruSeq Cancer Panel when using Illumina analysis pipelines. Adapter sequences for TruSeq Synthetic Long Reads are proprietary and removed during assembly.

• For more information on adapter trimming in Nextera Mate Pair, see the Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms technical note.

• The full adapter sequences for various Illumina library preparation kits can be found in the Illumina Adapter Sequences Document.

• Illumina Stranded mRNA Prep, Ligation and Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus require additional trimming of a T overhang at the 5’ end of the library. Please see "Trimming T-overhang options for the Illumina Stranded mRNA and Illumina Stranded Total RNA workflows" bulletin for further details

For any feedback or questions regarding this article (Illumina Knowledge Article #1314), contact Illumina Technical Support [e-mail].