Sequences to use for adapter trimming
When performing sequencing on an Illumina instrument, sequences corresponding to the library adapters can be present in the FASTQ files at the 3' end of the reads if the read length is longer than the insert size. To remove these sequences and prevent issues with downstream alignment, adapter trimmingis an option in Illumina FASTQ generation pipelines. Sample sheets generated with Illumina Experiment Manager contain the necessary sequences in the Settings section for Illumina kits. Illumina kits in BaseSpace Sequence Hub Prep, BaseSpace Sequence Hub Instrument Run Setup, and Local Run Manager have adapter information built into the software. However, some third-party tools require the adapter sequence for trimming be specified separately. The recommended sequences to use for each Illumina kit are as follows.
Note: if only one sequence is listed, that sequence is used for both reads of a paired-end run. Where the sequence differs between Read 1 and Read 2 of a paired end run, the sequence for each read is listed.
TruSeq single index (previously LT) and TruSeq CD index (previously HT)-based kits:
Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
AmpliSeq for Illumina; Illumina DNA Prep (M) Tagmentation (previously Nextera DNA Flex); Illumina DNA Prep with Enrichment (S) Tagmentation (previously Nextera Flex for Enrichment); Nextera DNA; Nextera XT; Nextera Enrichment; Nextera Rapid Capture Enrichment; TruPath Genome; TruSight Enrichment; TruSight Rapid Capture Enrichment; TruSight HLA; Illumina RNA Prep with Enrichment, Ligation:
CTGTCTCTTATACACATCT
Illumina DNA PCR-Free Prep, Tagmentation
CTGTCTCTTATACACATCT+ATGTGTATAAGAGACA
Illumina Stranded mRNA Prep, Ligation and Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus:
ACTGTCTCTTATACACATCT
ScriptSeq and TruSeq DNA Methylation:
Read 1: AGATCGGAAGAGCACACGTCTGAAC
Read 2: AGATCGGAAGAGCGTCGTGTAGGGA
TruSeq Small RNA:
TGGAATTCTCGGGTGCCAAGG
Notes:
The full adapter sequences for various Illumina library preparation kits can be found in the Illumina Adapter Sequences Document.
Illumina Stranded mRNA Prep, Ligation and Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus require additional trimming of a T overhang at the 5’ end of the library. See Trimming T-overhang options for the Illumina Stranded mRNA and Illumina Stranded Total RNA workflows for further details
For any feedback or questions regarding this article (Illumina Knowledge Article #1314), contact Illumina Technical Support [email protected].
Last updated
Was this helpful?
