> For the complete documentation index, see [llms.txt](https://knowledge.illumina.com/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://knowledge.illumina.com/software/cloud-software/software-cloud-software-troubleshooting-list/000009852.md).

# Troubleshooting DRAGEN single cell RNA App UMI error in BaseSpace

When running the DRAGEN Single Cell RNA (scRNA) pipeline v4.4.4 on BaseSpace (BSSH) with the Illumina Single Cell 3' RNA library prep kit, using a FASTQ file that does not have the UMI sequence in their FASTQ header will prevent proper cell barcode and UMI parsing, leading to a failed analysis.

**Symptoms**

Example dragen\_run log reports error:

Assertion failed in ../src/host/dragen\_api/umi/umi\_parser.cpp line 690 -- umiSection -- Read-name has fewer than 8 sections: VH00284:510:AACJNNCHV:1:1101:64888:1151

umiSection -- Read-name has fewer than 8 sections: VH00284:510:AACJNNCHV:1:1101:64888:1151

This error can happen \~45 minutes into the analysis, and will stop the analysis.

Example of a correct FASTQ header with UMI:

@VH00284:510:AACJNNCHV:1:1101:64888:1151:AGAGGAGTGATGGATGAAGAGTGGGTTTCGAGACAAAGAGTTCAC

The sequence starting with AGA is the barcode+UMI read

**Cause**

UMIs (Unique Molecular Identifiers) must be properly specified and passed during demultiplexing and FASTQ generation.

Common causes of UMI absence include:

1. UMIs not specified in the Sample Sheet during bcl2fastq or BCL Convert.
2. FASTQs generated with a tool that does not preserve UMI information in read headers.

**Resolution**

Option 1: Change the following settings in the pipeline:

* Barcode/UMI Read: Read 1
* Barcode/UMI Source: Barcode/UMI Read

This will pull the UMI information directly from Read 1 and allow the pipeline to bin the reads appropriately.

Option 2: create FASTQ files with the UMIs in the headers by requeuing the FASTQ file generation, specifying the correct Barcode/UMI Source: FASTQ Header. (More details on generating the FASTQ files is available [**here**](https://help.dragen.illumina.com/product-guide/dragen-v4.4/dragen-single-cell-pipeline/dragen-scrna)). Then, repeat the analysis with the correct FASTQ files.

\
\
\ <br>

|                                                                                                                                                                                                                                                                                                                                                                 |
| :-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------: |
| *For any feedback or questions regarding this article (Illumina Knowledge Article #9852), contact Illumina Technical Support* [*techsupport@illumina.com*](mailto:techsupport@illumina.com?subject=Question%2FFeedback%20Regarding%20Illumina%20Knowledge%20Article%20#000009852%20-%20Software%20\&body=Dear%20Illumina%20Technical%20Support,%0D%0A%0D%0A)*.* |


---

# Agent Instructions
This documentation is published with GitBook. GitBook is the documentation platform designed so that both humans and AI agents can read, navigate, and reason over technical content effectively. Learn more at gitbook.com.

## Querying This Documentation
If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter, and the optional `goal` query parameter:

```
GET https://knowledge.illumina.com/software/cloud-software/software-cloud-software-troubleshooting-list/000009852.md?ask=<question>&goal=<endgoal>
```

`ask` is the immediate question: it should be specific, self-contained, and written in natural language.
`goal` is optional and describes the broader end goal you are ultimately trying to accomplish on behalf of the user. GitBook uses it to tailor the answer towards what is most useful for that goal.

The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.