Illumina Connected SoftwareIllumina.comIllumina Support

Analysis frequently asked questions for the Illumina miRNA prep kit

What analysis pipeline should be used to analyze Illumina miRNA Prep data?

Is the analysis pipeline available in both BSSH and ICA for manual launch? Is there an autolaunch option?

  • Yes, it is available for both BSSH and ICA, no auto launch analysis supported. Customers should first run BCLConvert locally or on the cloud prior to triggering the app (either in ICA or BSSH), given that the app starts from FASTQs.

  • To demultiplex the samples with BCLConvert, please use Run Planning for creating the required sample sheet.

Will there be analysis app documentation on Gitbook?

Can the new DRAGEN miRNA analysis app identify novel miRNAs?

  • DRAGEN miRNA is not capable of discovering novel miRNAs from samples. The Illumina software only aligns reads to the miRNA database, but this is an optional tool for alignment. The assay itself will allow customers to capture novel miRNAs. Therefore, if a user was looking for novel sequences they could opt to align with their own tool and reference to do so.

What is the adapter trimming sequence?

  • Adapter trimming sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

  • Note: UMI parsing and 3’ Adapter trimming is handled by the DRAGEN miRNA app

How is adapter trimming handled?

  • The TruSeq adapter sequence (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA) is removed at the demultiplexing stage (via BCLConvert) prior to secondary analysis.

  • Once the UMI is parsed, the 3’ adapter sequence is removed at the secondary analysis step. After trimming, miRNA reads are classified accordingly.

What biological species does the analysis support?

The analysis supports the following species:

  • Human

  • Mouse

  • Rat

  • Zebrafish

  • Nematode

  • FruitflyMiRNA references are based upon the version v21 and v22 of the miRBase, customers can choose between the two versions when running an analysis.

For any feedback or questions regarding this article (Illumina Knowledge Article #9896), contact Illumina Technical Support [email protected].

Last updated

Was this helpful?