> For the complete documentation index, see [llms.txt](https://knowledge.illumina.com/llms.txt). Markdown versions of documentation pages are available by appending `.md` to page URLs; this page is available as [Markdown](https://knowledge.illumina.com/software/dragen/software-dragen-faq-list/000009896.md).

# Analysis frequently asked questions for the Illumina miRNA prep kit

**What analysis pipeline should be used to analyze Illumina miRNA Prep data?**

* The DRAGEN miRNA (v1.0.0 at product launch) pipeline app in [BaseSpace Sequence Hub (BSSH)](https://basespace.illumina.com/) or in ICA.

**Is the analysis pipeline available in both BSSH and ICA for manual launch? Is there an autolaunch option?**

* Yes, it is available for both BSSH and ICA, no auto launch analysis supported. Customers should first run BCLConvert locally or on the cloud prior to triggering the app (either in ICA or BSSH), given that the app starts from FASTQs.
* To demultiplex the samples with BCLConvert, please use Run Planning for creating the required sample sheet.

**Where is the analysis app documentation?**

* It is [here](https://help.connected.illumina.com/dragen-mirna).

**Can the new DRAGEN miRNA analysis app identify novel miRNAs?**

* DRAGEN miRNA is not capable of discovering novel miRNAs from samples. The Illumina software only aligns reads to the miRNA database, but this is an optional tool for alignment. The assay itself will allow customers to capture novel miRNAs. Therefore, if a user was looking for novel sequences they could opt to align with their own tool and reference to do so.

**What is the adapter trimming sequence?**

* Adapter trimming sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
* Note: UMI parsing and 3' Adapter trimming is handled by the DRAGEN miRNA app

**How is adapter trimming handled?**

* The TruSeq adapter sequence (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA) is removed at the demultiplexing stage (via BCLConvert) prior to secondary analysis.
* Once the UMI is parsed, the 3â€™ adapter sequence is removed at the secondary analysis step. After trimming, miRNA reads are classified accordingly.

**What biological species does the analysis support?**

The analysis supports the following species:

* Human
* Mouse
* Rat
* Zebrafish
* Nematode
* FruitflyMiRNA references are based upon the version v21 and v22 of the [miRBase](https://www.mirbase.org/), customers can choose between the two versions when running an analysis.

\
\
\ <br>

|                                                                                                                                                                                                                                                                                                                                                                 |
| :-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------: |
| *For any feedback or questions regarding this article (Illumina Knowledge Article #9896), contact Illumina Technical Support* [*techsupport@illumina.com*](mailto:techsupport@illumina.com?subject=Question%2FFeedback%20Regarding%20Illumina%20Knowledge%20Article%20#000009896%20-%20Software%20\&body=Dear%20Illumina%20Technical%20Support,%0D%0A%0D%0A)*.* |


---

# Agent Instructions
This documentation is published with GitBook. GitBook is the documentation platform designed so that both humans and AI agents can read, navigate, and reason over technical content effectively. Learn more at gitbook.com.

## Querying This Documentation
If you need additional information that is not directly available in this page, you can query the documentation dynamically by asking a question.

Perform an HTTP GET request on the current page URL with the `ask` query parameter, and the optional `goal` query parameter:

```
GET https://knowledge.illumina.com/software/dragen/software-dragen-faq-list/000009896.md?ask=<question>&goal=<endgoal>
```

`ask` is the immediate question: it should be specific, self-contained, and written in natural language.
`goal` is optional and describes the broader end goal you are ultimately trying to accomplish on behalf of the user. GitBook uses it to tailor the answer towards what is most useful for that goal.

The response will contain a direct answer to the question and relevant excerpts and sources from the documentation.

Use this mechanism when the answer is not explicitly present in the current page, you need clarification or additional context, or you want to retrieve related documentation sections.
