Ctrlk
Illumina Connected SoftwareIllumina.comIllumina Support
For the complete documentation index, see llms.txt. This page is also available as Markdown.

Analysis frequently asked questions for the Illumina miRNA prep kit

What analysis pipeline should be used to analyze Illumina miRNA Prep data?

  • The DRAGEN miRNA (v1.0.0 at product launch) pipeline app in BaseSpace Sequence Hub (BSSH) or in Illumina BioInsight Platform Core (Platform Core, formerly, Illumina Connected Analytics (ICA)).

Is the analysis pipeline available in both BSSH and Platform Core for manual launch? Is there an autolaunch option?

  • Yes, it is available for both BSSH and Platform Core, no autolaunch analysis supported. First run BCL Convert locally or on the cloud prior to triggering the app (either in Platform Core or BSSH), given that the app starts from FASTQs.

  • To demultiplex the samples with BCL Convert, use Run Planning for creating the required sample sheet.

Where is the analysis app documentation?

Can the new DRAGEN miRNA analysis app identify novel miRNAs?

  • DRAGEN miRNA is not capable of discovering novel MicroRNAs (miRNAs) from samples. The Illumina software only aligns reads to the miRNA database, but this is an optional tool for alignment. The assay itself will allow for capture novel miRNAs. Therefore, if a user were looking for novel sequences, they could opt to align with their own tool and reference to do so.

What is the adapter trimming sequence?

  • Adapter trimming sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

  • Note: Unique molecular identifiers (UMIs) parsing and 3' Adapter trimming is handled by the DRAGEN miRNA app.

How is adapter trimming handled?

  • The TruSeq adapter sequence (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA) is removed at the demultiplexing stage (via BCL Convert) prior to secondary analysis.

  • Once the UMI is parsed, the 3' adapter sequence is removed at the secondary analysis step. After trimming, miRNA reads are classified accordingly.

Which biological species does the analysis support?

The analysis supports the following species:

  • Human

  • Mouse

  • Rat

  • Zebrafish

  • Nematode

  • Fruitfly

miRNA references are based upon the version v21 and v22 of the miRBase, choose between the two versions when running an analysis.

For any feedback or questions regarding this article (Illumina Knowledge Article #9896), contact Illumina Technical Support techsupport@illumina.com.

Last updated

Was this helpful?